ARF4 cDNA

ARF4 is a member of the human ARF gene family whose members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 5 ARF proteins and 11 ARF-like proteins and constitute one family of the RAS superfamily. The ARF proteins are categorized as class I, class II and class III; this gene is a class II member. The members of each class share a common gene organization. The ARF4 gene spans approximately 12kb and contains six exons and five introns. This gene is the most divergent member of the human ARFs. Conflicting map positions at 3p14 or 3p21 have been reported for this gene.

ARF2

3p14.3

Human

PATGen (puc19-derived cloning vector)

ATGGGCCTCACTATCTCCTCCCTCTTCTCCCGACTATTTGGCAAGAAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGGTCAAGATAGAATTAGGCCTCTCTGGAAGCATTACTTCCAGAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAACGATCGTGAAAGAATTCAGGAAGTAGCAGATGAGCTGCAGAAAATGCTTCTGGTAGATGAATTGAGAGATGCAGTGCTGCTACTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAACTAGGGCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCAACACAAGGAACTGGTCTGTATGAAGGACTTGACTGGCTGTCAAATGAGCTTTCAAAACGTTAA

ARF4, ARF2, ARF4, ATGD0193-10 µg, ATGD0193-20 µg, ATGD0193-50 µg, ATGD0193-100 µg, ATGD0193-250 µg, ATGD0193-500 µg, ATGD0193-1 mg, ATGD0193-10, ATGD0193-20, ATGD0193-50, ATGD0193-100, ATGD0193-250, ATGD0193-500, ATGD0193-1

Store the plasmid at -20C.

Lyophilized

Signal Transduction

601177

NP_001651.1

Human

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

NM_001660.3

543bp

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.