NUTF2-cDNA

NUTF2 encoded by this gene is a cytosolic factor that facilitates protein transport into the nucleus. It interacts with the nuclear pore complex glycoprotein p62. This encoded protein acts at a relative late stage of nuclear protein import, subsequent to the initial docking of nuclear import ligand at the nuclear envelope. It is thought to be part of a multicomponent system of cytosolic factors that assemble at the pore complex during nuclear import.

Nuclear transport factor 2, NTF2, Placental protein 15, PP15, NuTF 2

16q22.1

Human

PATGen (puc19-derived cloning vector)

ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAATGATAGAACCCAACTAGGCGCAATTTACATTGACGCGTCATGCCTTACGTGGGAAGGACAACAGTTCCAGGGGAAAGCTGCCATTGTGGAGAAGTTGTCTAGCCTTCCGTTCCAGAAAATTCAGCACAGCATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCATGGTTGTGGGCCAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGACATGTTCAGGCTCGCCCTGCACAACTTTGGCTGA

PP15, PP 15, Placental protein 15, NUTF2, NUTF 2, Nuclear transport factor 2, NTF2, NTF 2, ATGD0115-10 µg, ATGD0115-20 µg, ATGD0115-50 µg, ATGD0115-100 µg, ATGD0115-250 µg, ATGD0115-500 µg, ATGD0115-1 mg, ATGD0115-010, ATGD0115-020, ATGD0115-050, ATGD0115-100, ATGD0115-250, ATGD0115-500, ATGD0115-01M

Store the plasmid at -20C.

Lyophilized

Adhesion & Movement

605813

NP_005787.1

Human

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

NM_005796.1

384bp

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.