
PSME1 cDNA
Kwaliteit
ISO Gecertificeerd
Levering
24-48 uur
Technische Specificaties
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants.
Proteasome activator subunit 1, 11S regulator complex subunit alpha, REG-alpha, Activator of multicatalytic protease subunit 1, Interferon gamma up-regulated I-5111 protein, IGUP I-5111, Proteasome activator 28 subunit alpha, PA28a, PA28alpha, IFI5111
14q11.2
Human
PATGen (puc19-derived cloning vector)
ATGGCCATGCTCAGGGTCCAGCCCGAGGCCCAAGCCAAGGTGGATGTGTTTCGTGAAGACCTCTGTACCAAGACAGAGAACCTGCTCGGGAGCTATTTCCCCAAGAAGATTTCTGAGCTGGATGCATTTTTAAAGGAGCCAGCTCTCAATGAAGCCAACTTGAGCAATCTGAAGGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAGAAGGGGGAGGATGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAAAAGATCGTGGTCCTTCTGCAGCGCTTGAAGCCTGAGATCAAGGATGTCATTGAGCAGCTCAACCTGGTCACCACCTGGTTGCAGCTGCAGATACCTCGGATTGAGGATGGTAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCAGCCTCCACACCAAGCTAGAAGGCTTCCACACTCAAATCTCTAAGTATTTCTCTGAGCGTGGTGATGCAGTGACTAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGCAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGA
REG-alpha, REGalpha, PSME1, Proteasome activator subunit 1, Proteasome activator complex subunit 1, Proteasome activator 28 subunit alpha, PA28alpha, PA28a, PA28 Activator a Subunit, MGC8628, Interferon gamma up-regulated I-5111 protein, IGUP I-5111, IFI5111, Activator of multicatalytic protease subunit 1, 11S regulator complex subunit alpha, REG alpha, PA28 alpha, PA28 A, Interferon gamma up regulated I-5111 protein, Interferon gamma up regulated I5111 protein, ATGD0128-10 µg, ATGD0128-20 µg, ATGD0128-50 µg, ATGD0128-100 µg, ATGD0128-250 µg, ATGD0128-500 µg, ATGD0128-1 mg, ATGD0128-010, ATGD0128-020, ATGD0128-050, ATGD0128-100, ATGD0128-250, ATGD0128-500, ATGD0128-01M
Store the plasmid at -20C.
Lyophilized
Ubiquitination
600654
NP_006254.1
Human
1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.
NM_006263.3
750bp
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Beschrijving
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core
Specificaties
Recent bekeken producten

Arachis hypogaea Lectin (PNA) - Biotinylated
21510020-1
5mg

1,4- Dioxane Pure
1041330 500
500 mL

Benzonase ELISA Kit
EG23601S
96 Tests

Not I Restriction Enzyme
B2016623
500 Units

K562-HLA-G0101 Overexpressing Cell Line
RG-1214
5x 10^6

Yeast Poly (A) Polymerase
RNT-006-S
30000 Units

Arachis hypogaea lectin (PNA)
05-0116-10mg
10 mg

Anti-APOE2 mouse monoclonal antibody
TD-AB0132
100 µg
