U2AF1L4 cDNA

U2AF1L4 is a RNA-binding protein that function as a pre-mRNA splicing factor. It plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3-splice site selection. U2AF1L4 acts by enhancing the binding of U2AF2 to weak pyrimidine tracts and also participates in the regulation of alternative pre-mRNA splicing.

U2AF1-RS3, U2AF1L3, U2AF1L3V1, U2AF1RS3, U2af26, U2 small nuclear RNA auxiliary factor 1 like 4, U2 (RNU2) small nuclear RNA auxiliary factor 1-like 3

19q13.12

Human

PATGen (puc19-derived cloning vector)

ATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGCTCTTTTTACTTTAAGATCGGGGTCTGCCGGCACGGGGACCGGTGCTCCCGGCTTCACAACAAGCCGACATTCAGCCAGGAGGTGTTCACAGAACTGCAGGAGAAGTATGGGGAGATTGAAGAGATGAATGTGTGCGACAACCTTGGGGACCACCTCGTGGGCAACGTCTATGTCAAGTTCCGGAGGGAGGAGGATGGAGAGCGGGCCGTGGCTGAACTCAGTAACCGCTGGTTCAACGGGCAGGCTGTGCACGGTGAGCTGTCTCCTGTCACTGACTTCCGGGAGTCATGCTGTCGCCAGTATGAGATGGGGGAATGTACCCGAGGTGGCTTCTGCAACTTCATGCATCTGCGGCCCATTTCCCAGAACCTCCAGAGGCAGCTCTATGGGCGGGGACCCAGGCGCAGGTCACCCCCGAGGTTCCATACTGGCCACCATCCCCGAGAGAGGAACCATCGGTGTTCCCCTGATCACTGGCATGGCCGCTTCTGA

U2af26, U2AF1-RS3, U2AF1RS3, U2AF1L4, U2AF1L3V1, U2AF1L3, U2AF1 RS3, U2 small nuclear RNA auxiliary factor 1-like 4, U2 small nuclear RNA auxiliary factor 1-like 3, U2 small nuclear RNA auxiliary factor 1 like 4, U2 small nuclear RNA auxiliary factor 1 like 3, ATGD0449-10 µg, ATGD0449-20 µg, ATGD0449-50 µg, ATGD0449-100 µg, ATGD0449-250 µg, ATGD0449-500 µg, ATGD0449-1 mg, ATGD0449-010, ATGD0449-020, ATGD0449-050, ATGD0449-100, ATGD0449-250, ATGD0449-500, ATGD0449-01M

Store the plasmid at -20C.

Lyophilized

Signal Transduction

601080

NP_001035515.1

Human

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

NM_001040425.2

546bp

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.